Bookmark and Share
BioAssay: AID 743269

TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of HIV-1 LEDGF/p75 DNA Integration

Name: TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of HIV-1 LEDGF/p75 DNA Integration. ..more
_
   
 Tested Compounds
 Tested Compounds
All(369939)
 
 
Active(2353)
 
 
Inactive(367589)
 
 
 Tested Substances
 Tested Substances
All(370276)
 
 
Active(2355)
 
 
Inactive(367921)
 
 
AID: 743269
Data Source: The Scripps Research Institute Molecular Screening Center (LEDGF-p75_INH_TRFRET_1536_1X%INH PRUN)
BioAssay Type: Primary, Primary Screening, Single Concentration Activity Observed
Depositor Category: NIH Molecular Libraries Probe Production Network
Deposit Date: 2014-01-31

Data Table ( Complete ):           Active    All
Targets
BioActive Compounds: 2353
Depositor Specified Assays
AIDNameTypeComment
743277Summary of a probe development effort to identify inhibitors of HIV-1 LEDGF/p75 DNA Integrationsummary
Description:
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center (SRIMSC)
Affiliation: Ohio State University
Assay Provider: Mamuka Kvaratskhelia, Ohio State University
Network: Molecular Library Probe Production Centers Network (MLPCN)
Grant Proposal Number: R01 AI081581
Grant Proposal PI: Mamuka Kvaratskhelia, Ohio State University
External Assay ID: LEDGF-p75_INH_TRFRET_1536_1X%INH PRUN

Name: TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of HIV-1 LEDGF/p75 DNA Integration.

Description:

HIV-1 integrase (IN) is an important therapeutic target in the fight against AIDS as its function is essential for viral replication. Multimeric IN catalyzes pair-wise integration of the linear viral DNA ends in a two-step reaction. The main novelty of the current approach is to discover new probes that stabilize functionally compromised IN multimers rather than interfere with IN multimerization (referred to as MINIs [multimeric IN inhibitors]). LEDGF/p75 is the principal cellular binding partner of HIV-1 IN and is essential for effective integration. Selective LEDGF/p75-IN inhibitors are referred to as LINIs. Using an in vitro model system we have demonstrated that HIV-1 IN is a highly dynamic protein and its ordered, temporal assembly with cognate DNA and cellular co-factor LEDGF/p75 is essential for catalytic activities (1-3). To form the stable and functional IN-viral DNA complex, individual IN subunits need to assemble in the presence of viral DNA. LEDGF/p75 promotes IN multimerization in the absence of viral DNA, however these preformed IN multimers are catalytically inactive (2-3). Since LEDGF/p75 is required for effective concerted integration in infected cells, it has been speculated that LEDGF/p75 engages preintegration complexes (PICs) only after the stable IN-viral DNA complex is formed. Our novel primary assay of LEDGF/p75-dependent integration will capture both MINIs and LINIs, whereas the two secondary assays of IN multimerization and IN-LEDGF/p75 binding will delineate these two classes of probes.

References:

1. Kessl, J. J., Eidahl, J. O., Shkriabai, N., Zhao, Z., McKee, C. J., Hess, S., Burke, T. R., Jr., and Kvaratskhelia, M. (2009) An allosteric mechanism for inhibiting HIV-1 integrase with a small molecule, Mol Pharmacol 76, 824-832.
2. Kessl, J. J., Li, M., Ignatov, M., Shkriabai, N., Eidahl, J. O., Feng, L., Musier-Forsyth, K., Craigie, R., and Kvaratskhelia, M. (2011) FRET analysis reveals distinct conformations of IN tetramers in the presence of viral DNA or LEDGF/p75, Nucleic Acids Res 39, 9009-9022.
3. McKee, C. J., Kessl, J. J., Shkriabai, N., Dar, M. J., Engelman, A., and Kvaratskhelia, M. (2008) Dynamic modulation of HIV-1 integrase structure and function by cellular lens epithelium-derived growth factor (LEDGF) protein, J Biol Chem 283, 31802-31812.
4. Kessl, J. J., Jena, N., Koh, Y., Taskent-Sezgin, H., Slaughter, A., Feng, L., de Silva, S., Wu, L., Le Grice, S. F., Engelman, A., Fuchs, J. R., and Kvaratskhelia, M. (2012) Multimode, cooperative mechanism of action of allosteric HIV-1 integrase inhibitors, J Biol Chem 287, 16801-16811.
5. Malet, I., Delelis, O., Valantin, M. A., Montes, B., Soulie, C., Wirden, M., Tchertanov, L., Peytavin, G., Reynes, J., Mouscadet, J. F., Katlama, C., Calvez, V., and Marcelin, A. G. (2008) Mutations associated with failure of raltegravir treatment affect integrase sensitivity to the inhibitor in vitro, Antimicrob Agents Chemother 52, 1351-1358.
6. Hare, S., Gupta, S. S., Valkov, E., Engelman, A., and Cherepanov, P. (2010) Retroviral intasome assembly and inhibition of DNA strand transfer, Nature 464, 232-236.
7. Li, M., Mizuuchi, M., Burke, T. R., Jr., and Craigie, R. (2006) Retroviral DNA integration: reaction pathway and critical intermediates, EMBO J 25, 1295-1304.
8. Christ, F., Voet, A., Marchand, A., Nicolet, S., Desimmie, B. A., Marchand, D., Bardiot, D., Van der Veken, N. J., Van Remoortel, B., Strelkov, S. V., De Maeyer, M., Chaltin, P., and Debyser, Z. (2010) Rational design of small-molecule inhibitors of the LEDGF/p75-integrase interaction and HIV replication, Nat Chem Biol 6, 442-448.
9. Christ, F., Shaw, S., Demeulemeester, J., Desimmie, B. A., Marchand, A., Butler, S., Smets, W., Chaltin, P., Westby, M., Debyser, Z., and Pickford, C. (2012) Small-molecule inhibitors of the LEDGF/p75 binding site of integrase block HIV replication and modulate integrase multimerization, Antimicrob Agents Chemother 56, 4365-4374
10. Tsiang, M., Jones, G. S., Niedziela-Majka, A., Kan, E., Lansdon, E. B., Huang, W., Hung, M., Samuel, D., Novikov, N., Xu, Y., Mitchell, M., Guo, H., Babaoglu, K., Liu, X., Geleziunas, R., and Sakowicz, R. (2012) New class of HIV-1 integrase (IN) inhibitors with a dual mode of action, J Biol Chem 287, 21189-21203.

Keywords:

Primary assay, PRUN, primary, HIV-1 Integrase, HIV-1, Integrase, AIDs, human acquired immunodeficiency virus, Eu, Cy5, DNA, Multimerization, multimer, MINIs, LINIs, TR-FRET, time resolved fluorescence energy transfer, fluorescence, HTRF, primary, Primary screen, PRUN, HTS, High Throughput Screening, 1536, Scripps, Scripps Florida, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Protocol
Assay Overview:

The purpose this assay is to identify small molecule probes that selectively modulate HIV integrase (IN) multimerization. The main novelty of our approach is to discover new probes that stabilize functionally compromised IN multimers rather than interfere with IN multimerization. Here we refer to such probes as MINIs (multimeric IN inhibitors). Discovery of MINIs through HTS will provide a new and powerful tool for structural and mechanistic studies to elucidate how different multimeric forms of IN interact with viral DNA as well as viral and cellular proteins at different stages of viral replication.

In this assay, test compounds are incubated with IN, followed by addition of DNA Substrates (50nM viral DNA-Cy5, 10nM target DNA substrate final concentrations) and LEDGE/p75 (100nM final concentration). After 30 min incubation Streptavidin-EuCryptate (2nM) is added to the wells. Plates are incubated for 2.5hrs after which HTRF is measured. As designed, compounds that prevent or inhibit IN multimerization will reduce the transfer of energy from Eu to Cy5, thereby inhibiting well FRET. Compounds will be tested in singlicate at a nominal concentration of 3.7 micromolar.

Protocol Summary:

Prior to the start of the assay, 1.5 uL of HIV1-Integrase (100nM final concentration) in assay buffer (20 mM Hepes, pH 7.5, buffer containing 1 mM DTT, 10 mM MgCl2, 10% glycerol, 0.05% Brij-35, 0.1 mg/ml BSA) and 1.5ul of Assay buffer to High Control wells. Next, 11 nl of compounds or DMSO alone (0.25% final concentration) were distributed into appropiate wells. The plates were incubated for 30 minutes at 25 C. The assay started by the addition of 1.5 ul of a mixture containing substrate DNA, viral DNA and LEDGF-p75. The plates were incubated for 2.5hrs at 25 C, after which 3ul of Streptavidin-Eu Cryptate was added to all wells to a final concentration of 1nM in detection buffer (20mM EDTA, 0.05% Brij35, 0.1mg/ml BSA). Plates were incubated for 1 hr, at which time TR-FRET was measured by the ViewLux microplate reader (PerkinElmer). Measurements were performed by exciting the plates at 340 nM, and monitoring well fluorescence at 618 nm (Eu) and 671 nm (Cy5) with the ViewLux microplate reader .

To normalize data, values measured from both fluorescence emission wavelengths were used to calculate a ratio for each well, according to the following mathematical expression:

Ratio = ( I671nm / I618nm )

Where:

I represents the measured fluorescence emission intensity at the enumerated wavelength in nm.

The percent inhibition was calculated from the median ratio as follows:

%_Inhibition = 100 * ( ( Ratio_Test_Compound - Median_Ratio_Sample_Field ) / ( Median_Ratio_High_Control - Median_Ratio_Sample_Field) ) )

Where:

Test_Compound is defined as wells containing test compound.
High_Control is defined as wells containing HIV1-Integrase and DMSO.
Low_Control is defined as wells containing HIV1-Integrase, vDNA, sDNA, LEDGF-p75 and DMSO
Sample_Field is defined as wells containing HIV1-Integrase, vDNA, sDNA, LEDGF-p75 and compounds in DMSO

PubChem Activity Outcome and Score:

A mathematical algorithm was used to determine nominally inhibiting compounds in the primary screen. Two values were calculated: (1) the average percent inhibition of all compounds tested, and (2) three times their standard deviation. The sum of these two values was used as a cutoff parameter, i.e. any compound that exhibited greater % inhibition than the cutoff parameter was declared active.

The reported PubChem Activity Score has been normalized to 100% observed primary inhibition. Negative % inhibition values are reported as activity score zero.

The PubChem Activity Score range for active compounds is 100-13, and for inactive compounds 13-0.

List of Reagents:

HIV-Interase (Supplied by assay provider)
LEDGF-p75 (Suppliedby assay provider)
vDNA (IDT: Custum Oligo-/5#Cy5/ATGTGGAAAATCTCTAGCAGT and /5#Cy5/ACTGCTAGAGATTTTCCACAT)
sDNA (IDT Custom Oligo-ACAGGCCTAGCACGCGTCG/3#Bio/ and CGACGCGTGCTAGGCCTGT/3#Bio/)
Eu-Streptavidin (Cisbio, part number 610SAKLA/B)
HEPES (Sigma Aldrich, part number 83264)
DTT (Sigma Aldrich, part number 16568)
Magnesium chloride (Sigma Aldrich, part number M8266)
glycerol (Sigma Aldrich, part number G7893)
BSA (Sigma Aldrich, part number A7906)
EDTA (Fisher, BP2482)
NaCl (Sigma Aldrich, part number 83264)
1536 well plates (Corning, 7254)
Comment
Due to the increasing size of the MLPCN compound library, this assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, and compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided by the MLSMR.
Result Definitions
TIDNameDescriptionHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
ScoreThe BioAssay activity ranking scoreInteger
1Inhibition at 3.7 uM (3.7μM**)Normalized percent inhibition of the primary screen at a compound concentration of 3.7 micromolar.Float%

** Test Concentration.
Additional Information
Grant Number: R01 AI081581

Data Table (Concise)
Classification
PageFrom: