Bookmark and Share
BioAssay: AID 651575

Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivity

Name: Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivity. ..more
_
   
 Tested Compounds
 Tested Compounds
All(9)
 
 
Probe(1)
 
 
Active(9)
 
 
 Tested Substances
 Tested Substances
All(9)
 
 
Probe(1)
 
 
Active(9)
 
 
AID: 651575
Data Source: The Scripps Research Institute Molecular Screening Center (CORE_INH_FLUOR_0096_SAR_ROUND_1 MDCSRUN QPCR)
BioAssay Type: Confirmatory, Concentration-Response Relationship Observed
Depositor Category: NIH Molecular Libraries Probe Production Network, Assay Provider
BioAssay Version:
Deposit Date: 2012-09-11
Hold-until Date: 2013-06-25
Modify Date: 2013-06-25

Data Table ( Complete ):           View Active Data    View All Data
Target
BioActive Compounds: Chemical Probe: 1    Active: 9
Related Experiments
Show more
AIDNameTypeProbeComment
1899TR-FRET-based primary biochemical high-throughput screening assay to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerizationScreening depositor-specified cross reference: Primary screen (HCV core protein dimerization inhibitors in singlicate)
1911Summary of probe development efforts to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerizationSummary depositor-specified cross reference: Summary (HCV core protein dimerization inhibitors)
2152TR-FRET-based biochemical high-throughput confirmation assay for inhibitors of Hepatitis C Virus (HCV) core protein dimerization.Screening depositor-specified cross reference: Confirmation screen (HCV core protein dimerization inhibitors in triplicate)
2159TR-FRET-based biochemical high-throughput dose response assay to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization.Confirmatory depositor-specified cross reference: Dose response (HCV core protein dimerization inhibitors in quadruplicate)
2488Late stage results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: TR-FRET-based biochemical dose response assay for HCV core inhibitorsConfirmatory depositor-specified cross reference: Late stage dose response (HCV core inhibitors in triplicate)
463085Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical AlphaScreen assay to identify inhibitors of HCV core dimerizationConfirmatory depositor-specified cross reference: Late stage Alpha Screen dose response (HCV core dimerization inhibitors in triplicate)
485271Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: fluorescence-based cell-based quantitative PCR assay to identify inhibitors of HCV infectivityConfirmatory depositor-specified cross reference: Late stage counterscreen (HCV infectivity inhibitors in triplicate)
485280Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Absorbance-based cell-based assay to identify compounds that are cytotoxic to Huh-7.5 cellsConfirmatory depositor-specified cross reference: Late stage counterscreen (Cytotoxicity in triplicate)
624406Late stage results from the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Cell-based radioligand binding assay to determine the binding affinities for selected transporters, receptors, and GPCRsOther depositor-specified cross reference: Late stage (selected transporters, receptors, and GPCRs binding affinities)
651574Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivity (2 timepoints)Other1 same project related to Summary assay
651576Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical AlphaScreen assay to identify inhibitors of HCV core dimerization (%INH 15uM)Other1 same project related to Summary assay
651577Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical dose response AlphaScreen assay to identify inhibitors of HCV core dimerizationConfirmatory1 same project related to Summary assay
651583Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Absorbance-based cell-based assay to identify compounds that are cytotoxic to Huh-7.5 cellsConfirmatory same project related to Summary assay
Description:
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center
Affiliation: The Scripps Research Institute, TSRI
Assay Provider: A.D. Strosberg, TSRI
Network: Molecular Library Probe Production Centers Network (MLPCN)
Grant Proposal Number: 1-X01-MH085709-01
Grant Proposal PI: A.D. Strosberg, TSRI
External Assay ID: CORE_INH_FLUOR_0096_SAR_ROUND_1 MDCSRUN QPCR

Name: Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivity.

Description:

The Hepatitis C Virus (HCV) is a major cause of liver failure and hepatocellular cancer, with about 170 million people infected worldwide (1). The HCV has a small RNA genome that is directly translated by the infected host cell into a single precursor polyprotein that is processed by enzymatic cleavage into 10 proteins of diverse function. The most N-terminal 21kDa protein of this HCV polyprotein is the HCV core (C) protein, which is a highly basic, RNA-binding structural protein essential for assembly and packaging of the viral genome (2). Core protein is cleaved by a host peptidase and anchored to the host cell endoplasmic reticulum, where it undergoes further processing into its mature form (3). The N terminal portion of this mature C protein mediates viral assembly through homodimerization and formation of higher order complexes with viral RNA to form the nucleocapsid, while the hydrophobic C terminal interacts with envelope glycoproteins to form the infectious particle (4). The conserved nature of the HCV protein and absence of a vaccine to prevent HCV infection (5), along with studies demonstrating that C protein contributes to host cell oncogenesis (6), apoptosis inhibition (7), and suppression of host T cell responses (8), support a role for core protein as a major pathogenic component of HCV. The identification of specific inhibitors of HCV core dimerization will provide valuable tools for inhibiting HCV assembly without host cell effects (9).

References:

1. Hoofnagle, J.H., Course and outcome of hepatitis C. Hepatology, 2002. 36(5 Suppl 1): p. s21-s29.
2. Lin, C., Lindenbach, B.D., Pragai, B.M., McCourt, D.W., and Rice, C.M., Processing in the hepatitis C virus E2-NS2 region: identification of p7 and two distinct E2-specific products with different C termini. J Virol, 1994. 68(8): p. 5063-73.
3. Moradpour, D. and Blum, H.E., A primer on the molecular virology of hepatitis C. Liver Int, 2004. 24(6): p. 519-25.
4. Majeau, N., Gagne, V., Boivin, A., Bolduc, M., Majeau, J.A., Ouellet, D., and Leclerc, D., The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation. J Gen Virol, 2004. 85(Pt 4): p. 971-81.
5. Yang, J.P., Zhou, D., and Wong-Staal, F., Screening of small-molecule compounds as inhibitors of HCV entry. Methods Mol Biol, 2009. 510: p. 295-304.
6. Ray, R.B., Lagging, L.M., Meyer, K., and Ray, R., Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J Virol, 1996. 70(7): p. 4438-43.
7. Marusawa, H., Hijikata, M., Chiba, T., and Shimotohno, K., Hepatitis C virus core protein inhibits Fas- and tumor necrosis factor alpha-mediated apoptosis via NF-kappaB activation. J Virol, 1999. 73(6): p. 4713-20.
8. Large, M.K., Kittlesen, D.J., and Hahn, Y.S., Suppression of host immune response by the core protein of hepatitis C virus: possible implications for hepatitis C virus persistence. J Immunol, 1999. 162(2): p. 931-8.
9. Kota S, Coito C, Mousseau G, Lavergne JP, Strosberg AD. Peptide inhibitors of hepatitis C virus core oligomerization and virus production. J Gen Virol. 2009 Jun;90(Pt 6):1319-28.

Keywords:

TCID, QPCR, Tissue Culture Infective Dose, late stage, late stage AID, powders, purchased, HCV, core protein, core 106, core, hepatitis, hepatitis C, RNA virus, protein-protein interaction, dimerization, dose response, cell-based, counterscreen, liver, assay provider, inhibitor, inhibition, inhibit, fluorescence, infectivity, Scripps, Scripps Florida, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Protocol
Assay Overview:

The purpose of this assay is to determine whether powder samples of compounds identified as possible HCV core probe candidates are able to block HCV infectivity of Huh-7.5 cells. In this assay HCV infectivity is measured using real-time RT-PCR to monitor changes in expression of HCV 2a J6/JFH-1 RNA. Cells are incubated with test compound in the presence of HCV, followed by isolation of RNA, conversion to cDNA, and Taqman-based QPCR. As designed, a compound that inhibits HCV infectivity will reduce HCV RNA expression, leading to decreased production of the PCR amplicon, thereby reducing fluorescence, and increasing Ct. Compounds were tested in triplicate in a 6-point 1:10 dilution series starting at a nominal test concentration of 100 uM.

Protocol Summary:

Cells were plated the day before the assay. After allowing the cells to adhere overnight, test compound was prepared in HCV supernatant by making 1:10 serial dilutions from 100 uM down to 0.001 uM. Doses of test compound in virus were added to cells and incubated for 24 hours. The next day, cell culture media was removed from each well and replaced with same dilutions of compound in complete media were added to cells and incubated for another 48 hours. Then cells were lysed and RNA was isolated using the RNeasy kit (QIAGEN, Valencia, CA). DNA was generated using the Taqman reverse transcription kit (Applied Biosystems, Foster City, CA). Quantitative real-time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM-TATGAGTGTCGTGCAGCCTC-MGBNFQ on a model LightCycler480 real time PCR system (Roche). Primers used were forward CTTCACGCAGAAAGCGTCTA and reverse CAAGCACCCTATCAGGCAGT.

The range of activity was normalized based on measurement of total RNA.

For each test compound, percent inhibition was plotted against the log of the compound concentration. A four parameter variable slope equation describing a sigmoidal dose-response curve was then fitted using GraphPad Prism (GraphPad Software Inc). The software-generated IC50 values are reported.

PubChem Activity Outcome and Score:

Compounds with a IC50 value greater than 20 uM were considered inactive. Compounds with a IC50 value equal to or less than 20 uM were considered active.

Activity score was then ranked by the potency of the compounds with fitted curves, with the most potent compounds assigned the highest activity scores.

The PubChem Activity Score range for active compounds is 100-1. There are no inactive compounds.

List of Reagents:

Huh-7.5 cell line (APATH)
DMEM medium (Invitrogen, 11995-073)
100X Penicillin-Streptomycin-Glutamine (Invitrogen, 10378-016)
Trypsin-EDTA solution (Invitrogen, 25200-056)
Fetal Bovine Serum (Akron, FBS-400-3D)
QiaShredder (Qiagen, 79656)
RNeasy mini kit (Qiagen, 74104)
LightCycler RNA Amplification Kit HybProbe (Roche, 12015145001)
Forward primer (Lifetech Applied Biosystems, CTTCACGCAGAAAGCGTCTA)
Reverse primer (Lifetech Applied Biosystems, CAAGCACCCTATCAGGCAGT)
MGBProbe (Lifetech Applied Biosystems, 4304971, 6FAM-TATGAGTGTCGTGCAGCCTC-MGBNFQ)
LightCycler480 multiwell plate 96 (Roche, 04729692001)
LightCycler480 sealing foil (Roche, 04729757001)
Comment
This assay was performed in the assay providers lab. This assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal.
Categorized Comment - additional comments and annotations
From PubChem:
Assay Format: Cell-based
Assay Cell Type: HUH7
Result Definitions
TIDNameDescriptionHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
ScoreThe BioAssay activity ranking scoreInteger
1IC50*The concentration at which 50 percent of the activity in the inhibitor assay is observed; (IC50) shown in micromolar.FloatμM

* Activity Concentration.
Additional Information
Grant Number: 1-X01-MH085709-01

Data Table (Concise)
Data Table ( Complete ):     View Active Data    View All Data
PageFrom: