Bookmark and Share
BioAssay: AID 540290

Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess CD36 gene expression changes associated with adipocyte differentiation in 3T3-L1 cells

Name: Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess CD36 gene expression changes associated with adipocyte differentiation in 3T3-L1 cells. ..more
_
   
 Tested Compounds
 Tested Compounds
All(1)
 
 
Inactive(1)
 
 
 Tested Substances
 Tested Substances
All(1)
 
 
Inactive(1)
 
 
 Related BioAssays
 Related BioAssays
AID: 540290
Data Source: The Scripps Research Institute Molecular Screening Center (ADIPOCYTE-CD36_GENE_ACT_QPCR_NON-AG)
Depositor Category: NIH Molecular Libraries Probe Production Network, Assay Provider
Deposit Date: 2011-07-23
Hold-until Date: 2012-07-19
Modify Date: 2012-07-19

Data Table ( Complete ):           View All Data
Target
Tested Compound:
Related Experiments
Show more
AIDNameTypeProbeComment
631Primary biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)Screening depositor-specified cross reference: Primary HTS in singlicate to identify SRC1 agonists.
1051Measurement of TR-FRET detection format artefact in the screen for agonists of steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)Other depositor-specified cross reference: Counter screen in triplicate to identify possible fluorescent artifacts.
1300Confirmation biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)Screening depositor-specified cross reference: Confirmation of hit activity in triplicate.
1319Dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)Confirmatory depositor-specified cross reference: Titration assays in triplicate to determine potency of selective compounds.
1679TR-FRET dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPAR gamma): non-selective agonistsConfirmatory depositor-specified cross reference: Titration assays in triplicate to determine potency of non-selective compounds.
1808Summary of probe development efforts to identify agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPAR gamma)Summary depositor-specified cross reference: Sumamry (SRC-1 recruitment by PPARg agonists)
504446TR-FRET-based biochemical dose response competitive binding lanthascreen assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)Confirmatory depositor-specified cross reference: Dose response Lanthascreen (PPARG partial agonists in triplicate)
504447Luminescence-based cell-based assay provider high throughput dose response assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)Confirmatory depositor-specified cross reference: CBI Dose response (PPARG partial agonists in triplicate)
504452Luminescence-based cell-based primary high throughput screening assay to identify partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)Screening depositor-specified cross reference: Primary screen (PPARG partial agonists in duplicate)
504453Fluorescence-polarization-based biochemical polarscreen dose response binding assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)Confirmatory depositor-specified cross reference: Dose response Polarscreen (PPARG partial agonists in triplicate)
504735Late stage assay provider counterscreen for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg): Luminescence-based cell-based dose response assay for partial agonists of the peroxisome proliferator-activated receptor alpha (PPARA).Confirmatory same project related to Summary assay
504938Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): chemiluminescence-based biochemical western blot assay for inhibitors of phosphorylation of PPARG protein levelsOther1 same project related to Summary assay
504939Late stage assay provider results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): Luminescence-based cell-based dose response assay to identify transactivation inhibitor of PPRE (PPARG response element)Confirmatory same project related to Summary assay
504943Late stage assay provider results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): TR-FRET-based biochemical dose response competitive binding lanthascreen assay for non-agonists of the PPARgConfirmatory same project related to Summary assay
540282Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assessPPAR-gamma (PPARG) gene expression changes associated with osteoblast differentiationOther same project related to Summary assay
540283Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess receptor activator of nuclear factor kappa-B ligand (RANKL) gene expression changes associated with osteoblast differentiationOther same project related to Summary assay
540284Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess type I collagen (col1) gene expression changes associated with osteoblast differentiationOther same project related to Summary assay
540285Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess alkaline phosphatase (Alp) gene expression changes associated with osteoblast differentiationOther same project related to Summary assay
540286Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess AP2 (fatty acid binding protein 4) gene expression changes associated with adipocyte differentiation in 3T3-L1 cellsOther same project related to Summary assay
540287Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess C/EBP-alpha gene expression changes associated with adipocyte differentiation in 3T3-L1 cellsOther same project related to Summary assay
540289Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess PPAR-gamma gene expression changes associated with adipocyte differentiation in 3T3-L1 cellsOther same project related to Summary assay
540291Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess Lpl gene expression changes associated with adipocyte differentiation in 3T3-L1 cellsOther same project related to Summary assay
540292Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess Fasn gene expression changes associated with adipocyte differentiation in 3T3-L1 cells.Other same project related to Summary assay
540293Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): Leptin-deficient ob/ob mouse model studies to assess the effect of probe candidate on fasting blood glucoseOther1 same project related to Summary assay
540294Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess Glut4 gene expression changes associated with adipocyte differentiation in 3T3-L1 cellsOther same project related to Summary assay
Description:
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center (SRISMC)
Center Affiliation: The Scripps Research Institute, TSRI
Assay Provider: Patrick Griffin, TSRI
Network: Molecular Library Probe Production Center Network (MLPCN)
Grant Proposal Number: U54 MH084512
Grant Proposal PI: Patrick Griffin, TSRI
External Assay ID: ADIPOCYTE-CD36_GENE_ACT_QPCR_NON-AG

Name: Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess CD36 gene expression changes associated with adipocyte differentiation in 3T3-L1 cells.

Description:

Peroxisome proliferator-activated receptors (PPARs) belong to the nuclear receptor superfamily and are lipid sensors functioning as ligand-dependent transcription factors regulating gene expression patterns of diverse biological processes (1, 2). PPARs play a critical role in metabolic processes such as glucose metabolism, lipid metabolism, and have been implicated in anti-atherogenic, anti-inflammatory as well as anti-hypertensive functions (3). Like other nuclear receptors, PPARs act as agonist-activated transcription factors, regulating specific PPARG gene transcription. PPARs have been shown to respond to small molecules and are well-documented for therapeutic actions triggered by synthetic agonists (4-6). Among the three isoforms of PPAR identified, PPAR gamma (NR1C3) is implicated in several important disorders such as atherosclerosis, diabetes, obesity and cancer, providing strong justification for the search for specific PPARg agonists that can be used to treat these pathologies. However, the clinical use of PPARg agonists has been associated with adverse effects that are mainly caused by the concomitant activation of various PPARG genes implicated in different physiological pathways. These side effects include weight gain through increased adipogenesis, renal fluid retention and plasma volume expansion, as well as toxic effects in the liver (7). To design safer and more selective PPARg agonists, the different physiological pathways triggered by PPARg activation have to be decoupled. Recently, new classes of PPARg ligands, the so called selective PPARg modulators (SPPARgMs), have been developed. These compounds respond as partial agonists in a GAL-4 luciferase assay and are assumed to display a different binding mode in the PPARg subunit compared to the full agonist, glitazones (8). Selective recruitment of transcriptional coactivators by partial agonists has also been demonstrated, suggesting that different PPARg binding mode leading to a distinct coactivator recruitment profile may explain the change in gene expression patterns compared to those of full agonists (glitazones). Further, due to their improved pharmacodynamic properties, there is substantial interest and need to develop insulin-sensitizing PPARg modulators with minimal classical activation of PPARg and reduced side effects, while maintaining robust antidiabetic efficacy (9-11). The objective of this project is to identify compounds that bind to PPARgamma and do not induce PPARg transactivation (ligands; non-agonists) (12).

References:

1. Chawla, A., et al., Nuclear receptors and lipid physiology: Opening the X-files. Science, 2001. 294(5548): p. 1866-1870.
2. Krey, G., et al., Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Molecular Endocrinology, 1997. 11(6): p. 779-791.
3. Bishop-Bailey, D., T. Hla, and T.D. Warner, Intimal smooth muscle cells as a PPARG for peroxisome proliferator-activated receptor-gamma ligand therapy. Circ Res, 2002. 91(3): p. 210-7.
4. Evans, R.M., G.D. Barish, and Y.X. Wang, PPARs and the complex journey to obesity. Nat Med, 2004. 10(4): p. 355-61.
5. Staels, B., et al., Mechanism of action of fibrates on lipid and lipoprotein metabolism. Circulation, 1998. 98(19): p. 2088-93.
6. Barish, G.D., V.A. Narkar, and R.M. Evans, PPAR delta: a dagger in the heart of the metabolic syndrome. J Clin Invest, 2006. 116(3): p. 590-7.
7. Berger, J.P., T.E. Akiyama, and P.T. Meinke, PPARs: therapeutic PPARGs for metabolic disease. Trends Pharmacol Sci, 2005. 26(5): p. 244-51.
8. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R, Santini C, Sahoo SP, Tolman RL, Smith RG, Moller DE. Novel peroxisome proliferator-activated receptor (PPAR) gamma and PPARdelta ligands produce distinct biological effects. J Biol Chem. 1999 Mar 5;274(10):6718-25.
9. Berger JP, Petro AE, Macnaul KL, Kelly LJ, Zhang BB, Richards K, Elbrecht A, Johnson BA, Zhou G, Doebber TW, Biswas C, Parikh M, Sharma N, Tanen MR, Thompson GM, Ventre J, Adams AD, Mosley R, Surwit RS, Moller DE.Distinct properties and advantages of a novel peroxisome proliferator-activated protein [gamma] selective modulator. Mol Endocrinol. 2003 Apr;17(4):662-76.
10. Minoura H, Takeshita S, Ita M, Hirosumi J, Mabuchi M, Kawamura I, Nakajima S, Nakayama O, Kayakiri H, Oku T, Ohkubo-Suzuki A, Fukagawa M, Kojo H, Hanioka K, Yamasaki N, Imoto T, Kobayashi Y, Mutoh S.
Eur J Pharmacol. 2004 Jun 28;494(2-3):273-81. Pharmacological characteristics of a novel nonthiazolidinedione insulin sensitizer, FK614.
11. Vidovic D, Busby SA, Griffin PR, Schurer SC. A combined ligand- and structure-based virtual screening protocol identifies subuM PPARg partial agonists. ChemMedChem. 2011 Jan 3;6(1):94-103.
12. Choi JH, Banks AS, Estall JL, Kajimura S, Bostrom P, Laznik D, Ruas JL, Chalmers MJ, Kamenecka TM, Bluher M, Griffin PR, Spiegelman BM. Anti-diabetic drugs inhibit obesity-linked phosphorylation of PPARgamma by Cdk5. Nature. 2010 Jul 22;466(7305):451-6.

Keywords:

adipogenesis, adipocyte, fat, lipid, 3T3, 3T3-L1, probe, differentiation, QPCR, RTPCR, SYBR green, SYBR, RNA, polymerase chain reaction, PCR, cDNA, mRNA, counterscreen, PPARG, Late stage, late stage AID, powders, purchased, synthesized, PPAR gamma, PPARg, PPARG1, PPARG2, PPAR, peroxisome proliferator-activated receptor gamma, partial agonist, agonist, non-agonist, ligand, inhibit, assay provider, CBI, center based initiative, center-based, biochemical, selective, nuclear receptor, tumor, cancer, dose response, triplicate, Scripps Florida, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Protocol
Assay Overview:

The purpose of this assay is to determine whether powder samples of a compound identified as a novel PPARG ligand and non-agonist probe candidate (ML244) modulates the expression of CD36 gene involved in the differentiation of adipocytes. The probe should not be active in this assay. This assay employs the differentiated mouse 3T3-L1 cell line. The compound was tested at 10 uM.

Protocol Summary:

3T3-L1 cells were cultured in Alpha-MEM supplemented with 10% FBS, 1% penicillin-streptomycin, 200 uM ascorbic acid and 10 mM-glycerophosphate. The cells were treated with either Rosiglitazone (10 uM) or SR1664 (10 uM) or left in vehicle at the start of differentiation. The cells were harvested 7 days post-differentiation for gene expression analysis and 21 days post-differentiation for mineralization. The mineralization of MC3T3-E1 cells was determined by Alizarin red S staining (Millipore ECM815) as per manufacturer's instructions. Total RNA was isolated from cells using Trizol reagents. The RNA was reverse-transcribed using the ABI reverse transcription kit. Quantitative PCR reactions were performed with SYBR green fluorescent dye using an ABI9300 PCR machine. Relative mRNA expression was determined by the delta-delta-Ct method. The gene expression was normalized to GAPDH and compared to levels in cells treated with DMSO (mRNA level set as 1.0).

PubChem Activity Outcome and Score:

Compounds that modified (increased or decreased) gene expression by 200% or greater (ie, induced a 2X-fold change in expression) compared to the DMSO levels (set at 1.0) were active in this assay. Compounds that modified (increased or decreased) gene expression to levels less than 200% of the DMSO level (set as 1.0) were active in this assay. The probe was inactive.

The PubChem Activity Score is assigned a value of 100 for probe compounds, 50 for actives and 0 for inactives.

The PubChem Activity Score range for inactive compounds is 0-0. There are no active compounds.

List of Reagents:

Differentiated 3T3-L1 cells; Trizol Reagent (Invitrogen)
ABI Reverse Transcription Kit; SYBR Green dye (ABI)
PCR primers were ordered as appropriate. The primer pair sequences for CD36 gene target is indicated below:
Forward: AAGCTATTGCGACATGATT
Reverse: GATCCGAACACAGCGTAGAT
Comment
This assay was run by the assay provider. This assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. Possible artifacts of this assay can include, but are not limited to cytotoxic compounds and compounds that modulate protein synthesis or processing. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided.
Categorized Comment - additional comments and annotations
From PubChem:
Assay Format: Cell-based
Assay Cell Type: 3T3-L1
Result Definitions
TIDNameDescriptionHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
1Fold Change at 10 uM (10μM**)Fold mRNA Expression Change at 10 uM concentration; average of triplicate measurement.Floatratio

** Test Concentration.
Additional Information
Grant Number: U54 MH084512

Data Table (Concise)
Data Table ( Complete ):     View All Data
PageFrom: