Bookmark and Share
BioAssay: AID 540284

Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess type I collagen (col1) gene expression changes associated with osteoblast differentiation

Name: Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess type I collagen (col1) gene expression changes associated with osteoblast differentiation. ..more
_
   
 Tested Compounds
 Tested Compounds
All(1)
 
 
Inactive(1)
 
 
 Tested Substances
 Tested Substances
All(1)
 
 
Inactive(1)
 
 
 Related BioAssays
 Related BioAssays
AID: 540284
Data Source: The Scripps Research Institute Molecular Screening Center (OSTEOBLAST-COL1_GENE_INH_QPCR_NON-AG)
Depositor Category: NIH Molecular Libraries Probe Production Network, Assay Provider
Deposit Date: 2011-07-22
Hold-until Date: 2012-07-18
Modify Date: 2012-07-18

Data Table ( Complete ):           All
Target
Tested Compound:
Depositor Specified Assays
Show more
AIDNameTypeComment
631Primary biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)screeningPrimary HTS in singlicate to identify SRC1 agonists.
1051Measurement of TR-FRET detection format artefact in the screen for agonists of steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)otherCounter screen in triplicate to identify possible fluorescent artifacts.
1300Confirmation biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)screeningConfirmation of hit activity in triplicate.
1319Dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPARgamma)confirmatoryTitration assays in triplicate to determine potency of selective compounds.
1679TR-FRET dose response biochemical High Throughput Screening assay for agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPAR gamma): non-selective agonistsconfirmatoryTitration assays in triplicate to determine potency of non-selective compounds.
1808Summary of probe development efforts to identify agonists of the steroid receptor coactivator 1 (SRC-1) recruitment by the peroxisome proliferator-activated receptor gamma (PPAR gamma)summarySumamry (SRC-1 recruitment by PPARg agonists)
504446TR-FRET-based biochemical dose response competitive binding lanthascreen assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)confirmatoryDose response Lanthascreen (PPARG partial agonists in triplicate)
504447Luminescence-based cell-based assay provider high throughput dose response assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)confirmatoryCBI Dose response (PPARG partial agonists in triplicate)
504452Luminescence-based cell-based primary high throughput screening assay to identify partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)screeningPrimary screen (PPARG partial agonists in duplicate)
504453Fluorescence-polarization-based biochemical polarscreen dose response binding assay for partial agonists of the peroxisome proliferator-activated receptor gamma (PPARg)confirmatoryDose response Polarscreen (PPARG partial agonists in triplicate)
Description:
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center (SRISMC)
Center Affiliation: The Scripps Research Institute, TSRI
Assay Provider: Patrick Griffin, TSRI
Network: Molecular Library Probe Production Center Network (MLPCN)
Grant Proposal Number: U54 MH084512
Grant Proposal PI: Patrick Griffin, TSRI
External Assay ID: OSTEOBLAST-COL1_GENE_INH_QPCR_NON-AG

Name: Late stage assay provider counterscreen results from the probe development effort to identify non-agonists of the peroxisome proliferator-activated receptor gamma (PPARg): fluorescence-based cell-based quantitative polymerase chain reaction assay to assess type I collagen (col1) gene expression changes associated with osteoblast differentiation.

Description:

Peroxisome proliferator-activated receptors (PPARs) belong to the nuclear receptor superfamily and are lipid sensors functioning as ligand-dependent transcription factors regulating gene expression patterns of diverse biological processes (1, 2). PPARs play a critical role in metabolic processes such as glucose metabolism, lipid metabolism, and have been implicated in anti-atherogenic, anti-inflammatory as well as anti-hypertensive functions (3). Like other nuclear receptors, PPARs act as agonist-activated transcription factors, regulating specific PPARG gene transcription. PPARs have been shown to respond to small molecules and are well-documented for therapeutic actions triggered by synthetic agonists (4-6). Among the three isoforms of PPAR identified, PPAR gamma (NR1C3) is implicated in several important disorders such as atherosclerosis, diabetes, obesity and cancer, providing strong justification for the search for specific PPARg agonists that can be used to treat these pathologies. However, the clinical use of PPARg agonists has been associated with adverse effects that are mainly caused by the concomitant activation of various PPARG genes implicated in different physiological pathways. These side effects include weight gain through increased adipogenesis, renal fluid retention and plasma volume expansion, as well as toxic effects in the liver (7). To design safer and more selective PPARg agonists, the different physiological pathways triggered by PPARg activation have to be decoupled. Recently, new classes of PPARg ligands, the so called selective PPARg modulators (SPPARgMs), have been developed. These compounds respond as partial agonists in a GAL-4 luciferase assay and are assumed to display a different binding mode in the PPARg subunit compared to the full agonist, glitazones (8). Selective recruitment of transcriptional coactivators by partial agonists has also been demonstrated, suggesting that different PPARg binding mode leading to a distinct coactivator recruitment profile may explain the change in gene expression patterns compared to those of full agonists (glitazones). Further, due to their improved pharmacodynamic properties, there is substantial interest and need to develop insulin-sensitizing PPARg modulators with minimal classical activation of PPARg and reduced side effects, while maintaining robust antidiabetic efficacy (9-11). The objective of this project is to identify compounds that bind to PPARgamma and do not induce PPARg transactivation (ligands; non-agonists) (12).

References:

1. Chawla, A., et al., Nuclear receptors and lipid physiology: Opening the X-files. Science, 2001. 294(5548): p. 1866-1870.
2. Krey, G., et al., Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Molecular Endocrinology, 1997. 11(6): p. 779-791.
3. Bishop-Bailey, D., T. Hla, and T.D. Warner, Intimal smooth muscle cells as a PPARG for peroxisome proliferator-activated receptor-gamma ligand therapy. Circ Res, 2002. 91(3): p. 210-7.
4. Evans, R.M., G.D. Barish, and Y.X. Wang, PPARs and the complex journey to obesity. Nat Med, 2004. 10(4): p. 355-61.
5. Staels, B., et al., Mechanism of action of fibrates on lipid and lipoprotein metabolism. Circulation, 1998. 98(19): p. 2088-93.
6. Barish, G.D., V.A. Narkar, and R.M. Evans, PPAR delta: a dagger in the heart of the metabolic syndrome. J Clin Invest, 2006. 116(3): p. 590-7.
7. Berger, J.P., T.E. Akiyama, and P.T. Meinke, PPARs: therapeutic PPARGs for metabolic disease. Trends Pharmacol Sci, 2005. 26(5): p. 244-51.
8. Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y, Tanen M, Ventre J, Wu MS, Berger GD, Mosley R, Marquis R, Santini C, Sahoo SP, Tolman RL, Smith RG, Moller DE. Novel peroxisome proliferator-activated receptor (PPAR) gamma and PPARdelta ligands produce distinct biological effects. J Biol Chem. 1999 Mar 5;274(10):6718-25.
9. Berger JP, Petro AE, Macnaul KL, Kelly LJ, Zhang BB, Richards K, Elbrecht A, Johnson BA, Zhou G, Doebber TW, Biswas C, Parikh M, Sharma N, Tanen MR, Thompson GM, Ventre J, Adams AD, Mosley R, Surwit RS, Moller DE.Distinct properties and advantages of a novel peroxisome proliferator-activated protein [gamma] selective modulator. Mol Endocrinol. 2003 Apr;17(4):662-76.
10. Minoura H, Takeshita S, Ita M, Hirosumi J, Mabuchi M, Kawamura I, Nakajima S, Nakayama O, Kayakiri H, Oku T, Ohkubo-Suzuki A, Fukagawa M, Kojo H, Hanioka K, Yamasaki N, Imoto T, Kobayashi Y, Mutoh S.
Eur J Pharmacol. 2004 Jun 28;494(2-3):273-81. Pharmacological characteristics of a novel nonthiazolidinedione insulin sensitizer, FK614.
11. Vidovic D, Busby SA, Griffin PR, Schurer SC. A combined ligand- and structure-based virtual screening protocol identifies subuM PPARg partial agonists. ChemMedChem. 2011 Jan 3;6(1):94-103.
12. Choi JH, Banks AS, Estall JL, Kajimura S, Bostrom P, Laznik D, Ruas JL, Chalmers MJ, Kamenecka TM, Bluher M, Griffin PR, Spiegelman BM. Anti-diabetic drugs inhibit obesity-linked phosphorylation of PPARgamma by Cdk5. Nature. 2010 Jul 22;466(7305):451-6.

Keywords:

Bone, osteoblast, differentiation, probe, QPCR, RTPCR, SYBR green, SYBR, RNA, polymerase chain reaction, PCR, cDNA, mRNA, counterscreen, PPARG, Late stage, late stage AID, powders, purchased, synthesized, PPAR gamma, PPARg, PPARG1, PPARG2, PPAR, peroxisome proliferator-activated receptor gamma, partial agonist, agonist, non-agonist, ligand, inhibit, assay provider, CBI, center based initiative, center-based, biochemical, selective, nuclear receptor, tumor, cancer, dose response, triplicate, Scripps Florida, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Protocol
Assay Overview:

The purpose of this assay is to determine whether powder samples of a compound identified as a novel PPARG ligand and non-agonist probe candidate modulates the expression of the type I collagen (col1) gene involved in the differentiation of osteoblasts. The probe should not be active in this assay. This assay employs the MC3T3-E1 mouse osteoblastic cell line. The compound was tested at 10 uM.

Protocol Summary:

MC3T3-E1 cells were cultured in alpha-minimal essential medium (a-MEM) supplemented with 200 uM ascorbic acid and 10 mM B-glycerophosphate for 7 days. The cells were treated with DMSO, rosiglitazone (10 uM) or probe candidate SR1664 (10 uM) at the start of differentiation. Total RNA was isolated from cells using Trizol reagents. The RNA was reverse-transcribed using the ABI reverse transcription kit. Quantitative PCR reactions were performed with SYBR green fluorescent dye using an ABI9300 PCR machine. Relative mRNA expression was determined by the delta-delta-Ct method. The gene expression was normalized to GAPDH and compared to levels in cells treated with DMSO (mRNA level set as 1.0).

PubChem Activity Outcome and Score:

Compounds that modified (increased or decreased) gene expression by 20% or greater compared to the DMSO levels (set at 1.0) were active in this assay. Compounds that modified (increased or decreased) gene expression to levels less than 20% of the DMSO level (set as 1.0) were active in this assay. The probe was inactive.

The PubChem Activity Score is assigned a value of 100 for probe compounds, 50 for actives and 0 for inactives.

The PubChem Activity Score range for inactive compounds is 0-0. There are no active compounds.

List of Reagents:

MC3T3-E1 cells
Trizol Reagent (Invitrogen)
ABI Reverse Transcription Kit
SYBR Green dye (ABI)
PCR primers were ordered as appropriate.
The primer pair sequences for the col1 gene target is indicated below:
Forward: CCGGAAGAATACGTATCACC
Reverse: ACCAGGAGGACCAGGAAGTC
Comment
This assay was run by the assay provider. This assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. Possible artifacts of this assay can include, but are not limited to cytotoxic compounds and compounds that modulate protein synthesis or processing. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided.
Result Definitions
TIDNameDescriptionHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
1Fold Change at 10 uM (10μM**)Fold mRNA Expression Change at 10 micromolar concentration; average of triplicate measurement.Floatratio

** Test Concentration.
Additional Information
Grant Number: U54 MH084512

Data Table (Concise)
PageFrom: