Bookmark and Share
BioAssay: AID 485271

Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: fluorescence-based cell-based quantitative PCR assay to identify inhibitors of HCV infectivity

Name: Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: fluorescence-based cell-based quantitative PCR assay to identify inhibitors of HCV infectivity. ..more
_
   
 Tested Compounds
 Tested Compounds
All(1)
 
 
Active(1)
 
 
 Tested Substances
 Tested Substances
All(1)
 
 
Active(1)
 
 
AID: 485271
Data Source: The Scripps Research Institute Molecular Screening Center (CORE_INH_FLUOR_0096_FOLD-CHANGE QPCR SAR_ROUND_0 MDCSRUN)
BioAssay Type: Panel, Confirmatory, Concentration-Response Relationship Observed
Depositor Category: NIH Molecular Libraries Probe Production Network, Assay Provider
BioAssay Version:
Deposit Date: 2010-09-24
Hold-until Date: 2011-09-22
Modify Date: 2011-09-22

Data Table ( Complete ):           Active    All
Target
BioActive Compound: 1
Depositor Specified Assays
Show more
AIDNameTypeProbeComment
1899TR-FRET-based primary biochemical high-throughput screening assay to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerizationscreening Primary screen (HCV core protein dimerization inhibitors in singlicate)
1911Summary of probe development efforts to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerizationsummary Summary (HCV core protein dimerization inhibitors)
2152TR-FRET-based biochemical high-throughput confirmation assay for inhibitors of Hepatitis C Virus (HCV) core protein dimerization.screening Confirmation screen (HCV core protein dimerization inhibitors in triplicate)
2159TR-FRET-based biochemical high-throughput dose response assay to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization.confirmatory Dose response (HCV core protein dimerization inhibitors in quadruplicate)
2488Late stage results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: TR-FRET-based biochemical dose response assay for HCV core inhibitorsconfirmatory Late stage dose response (HCV core inhibitors in triplicate)
463085Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical AlphaScreen assay to identify inhibitors of HCV core dimerizationconfirmatory Late stage Alpha Screen dose response (HCV core dimerization inhibitors in triplicate)
624406Late stage results from the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Cell-based radioligand binding assay to determine the binding affinities for selected transporters, receptors, and GPCRsother
651575Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivityconfirmatory1
651576Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical AlphaScreen assay to identify inhibitors of HCV core dimerization (%INH 15uM)other1
651577Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Luminescence-based biochemical dose response AlphaScreen assay to identify inhibitors of HCV core dimerizationconfirmatory1
651574Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Fluorescence-based cell-based Quantitative Polymerase Chain Reaction (QPCR) assay to identify inhibitors of HCV infectivity (2 timepoints)other1
651583Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: Absorbance-based cell-based assay to identify compounds that are cytotoxic to Huh-7.5 cellsconfirmatory
Description:
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center
Affiliation: The Scripps Research Institute, TSRI
Assay Provider: A.D. Strosberg, TSRI
Network: Molecular Library Probe Production Centers Network (MLPCN)
Grant Proposal Number: 1-X01-MH085709-01
Grant Proposal PI: A.D. Strosberg, TSRI
External Assay ID: CORE_INH_FLUOR_0096_FOLD-CHANGE QPCR SAR_ROUND_0 MDCSRUN

Name: Late stage assay provider counterscreen results for the probe development effort to identify inhibitors of Hepatitis C Virus (HCV) core protein dimerization: fluorescence-based cell-based quantitative PCR assay to identify inhibitors of HCV infectivity.

Description:

The Hepatitis C Virus (HCV) is a major cause of liver failure and hepatocellular cancer, with about 170 million people infected worldwide (1). The HCV has a small RNA genome that is directly translated by the infected host cell into a single precursor polyprotein that is processed by enzymatic cleavage into 10 proteins of diverse function. The most N-terminal 21kDa protein of this HCV polyprotein is the HCV core (C) protein, which is a highly basic, RNA-binding structural protein essential for assembly and packaging of the viral genome (2). Core protein is cleaved by a host peptidase and anchored to the host cell endoplasmic reticulum, where it undergoes further processing into its mature form (3). The N terminal portion of this mature C protein mediates viral assembly through homodimerization and formation of higher order complexes with viral RNA to form the nucleocapsid, while the hydrophobic C terminal interacts with envelope glycoproteins to form the infectious particle (4). The conserved nature of the HCV protein and absence of a vaccine to prevent HCV infection (5), along with studies demonstrating that C protein contributes to host cell oncogenesis (6), apoptosis inhibition (7), and suppression of host T cell responses (8), support a role for core protein as a major pathogenic component of HCV. The identification of specific inhibitors of HCV core dimerization will provide valuable tools for inhibiting HCV assembly without host cell effects (9).

References:

1. Hoofnagle, J.H., Course and outcome of hepatitis C. Hepatology, 2002. 36(5 Suppl 1): p. s21-s29.
2. Lin, C., Lindenbach, B.D., Pragai, B.M., McCourt, D.W., and Rice, C.M., Processing in the hepatitis C virus E2-NS2 region: identification of p7 and two distinct E2-specific products with different C termini. J Virol, 1994. 68(8): p. 5063-73.
3. Moradpour, D. and Blum, H.E., A primer on the molecular virology of hepatitis C. Liver Int, 2004. 24(6): p. 519-25.
4. Majeau, N., Gagne, V., Boivin, A., Bolduc, M., Majeau, J.A., Ouellet, D., and Leclerc, D., The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation. J Gen Virol, 2004. 85(Pt 4): p. 971-81.
5. Yang, J.P., Zhou, D., and Wong-Staal, F., Screening of small-molecule compounds as inhibitors of HCV entry. Methods Mol Biol, 2009. 510: p. 295-304.
6. Ray, R.B., Lagging, L.M., Meyer, K., and Ray, R., Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype. J Virol, 1996. 70(7): p. 4438-43.
7. Marusawa, H., Hijikata, M., Chiba, T., and Shimotohno, K., Hepatitis C virus core protein inhibits Fas- and tumor necrosis factor alpha-mediated apoptosis via NF-kappaB activation. J Virol, 1999. 73(6): p. 4713-20.
8. Large, M.K., Kittlesen, D.J., and Hahn, Y.S., Suppression of host immune response by the core protein of hepatitis C virus: possible implications for hepatitis C virus persistence. J Immunol, 1999. 162(2): p. 931-8.
9. Kota S, Coito C, Mousseau G, Lavergne JP, Strosberg AD. Peptide inhibitors of hepatitis C virus core oligomerization and virus production. J Gen Virol. 2009 Jun;90(Pt 6):1319-28.

Keywords:

late stage, late stage AID, powders, purchased, HCV, core protein, core 106, core, hepatitis, hepatitis C, RNA virus, protein-protein interaction, dimerization, dose response, cell-based, counterscreen, QPCR, quantitative, PCR, polymerase chain reaction, gene expression, TaqMan, liver, hepatocytes, assay provider, inhibitor, inhibition, inhibit, fluorescence, infectivity, Scripps, Scripps Florida, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Panel Information
Assays
PID§NameSubstancePanel TargetsDescriptionAdditional Information
ActiveInactive
1Timepoint 12core protein [Hepatitis C virus] [gi:83779224]
Taxonomy id: 11103
2Timepoint 22core protein [Hepatitis C virus] [gi:83779224]
Taxonomy id: 11103

§ Panel component ID.
Protocol
Assay Overview:

The purpose of this assay is to determine whether powder samples of compounds identified as possible HCV core probe candidates are able to block HCV infectivity of Huh-7.5 cells. In this assay HCV infectivity is measured using real-time RT-PCR to monitor changes in expression of HCV 2a J6/JFH-1 RNA. Cells are incubated with test compound in the presence of HCV, followed by isolation of RNA, conversion to cDNA, and Taqman-based QPCR. As designed, a compound that inhibits HCV infectivity will reduce HCV RNA expression, leading to decreased production of the PCR amplicon, thereby reducing fluorescence, and increasing Ct. Compounds were tested in triplicate in a 6-point 1:10 dilution series starting at a nominal test concentration of 100 uM.

Protocol Summary:

Cells were plated the day before the assay. After allowing the cells to adhere overnight, test compound was prepared in HCV supernatant by making 1:10 serial dilutions from 100 uM down to 0.001 uM. Doses of test compound in virus were added to cells and incubated for 24 hours. The next day, cell culture media was removed from each well and replaced with same dilutions of compound in complete media were added to cells and incubated for another 48 hours for T1 timepoint. Then cells were lysed and RNA was isolated using the RNeasy kit (QIAGEN, Valencia, CA). Supernatant from T1 was transferred to fresh naive cells and incubated for 24 hours. Culture media were removed from cells and replaced with complete media and incubated for 48 hours for T2 timepoint. Cells for T2 timepoint were lysed and RNA was isolated using the RNeasy kit (QIAGEN, Valencia, CA). DNA was generated using the Taqman reverse transcription kit (Applied Biosystems, Foster City, CA). Quantitative real-time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM-TATGAGTGTCGTGCAGCCTC-MGBNFQ on a model LightCycler480 real time PCR system (Roche). Data are expressed as the mean fold change plus or minus SE of 3 replicates normalized to 100ug total RNA. Primers used were forward CTTCACGCAGAAAGCGTCTA and reverse CAAGCACCCTATCAGGCAGT.

The range of activity was normalized based on measurement of total RNA.

PubChem Activity Outcome and Score:

The following applies to each panel in this assay:

Compounds with a IC50 value greater than 20 uM were considered inactive. Compounds with a IC50 value equal to or less than 20 uM were considered active.

Activity score was then ranked by the potency of the compounds with fitted curves, with the most potent compounds assigned the highest activity scores.

Timepoint 1 Score: The PubChem Activity Score range for active compounds is 100-100. There are no inactive compounds.

Timepoint 2 Score: The PubChem Activity Score range for active compounds is 100-100. There are no inactive compounds.

Overall Outcome and Score:

The overall outcome was active if the compound was active in at least one panel, inactive otherwise.

The overall score is 0 if the compound was inactive, otherwise the score is the fraction of panels where the compound is active, multiplied by 100.

The PubChem Activity Score range for active compounds is 100-100. There are no inactive compounds.

List of Reagents:

Huh-7.5 cell line (APATH)
DMEM medium (Invitrogen, 11995-073)
100X Penicillin-Streptomycin-Glutamine (Invitrogen, 10378-016)
Trypsin-EDTA solution (Invitrogen, 25200-056)
Fetal Bovine Serum (Akron, FBS-400-3D)
QiaShredder (Qiagen, 79656)
RNeasy mini kit (Qiagen, 74104)
LightCylcer RNA Amplification Kit HybProbe (Roche, 12015145001)
Forward primer (Lifetech Applied Biosystems, CTTCACGCAGAAAGCGTCTA)
Reverse primer (Lifetech Applied Biosystems, CAAGCACCCTATCAGGCAGT)
MGBProbe (Lifetech Applied Biosystems, 4304971, 6FAM-TATGAGTGTCGTGCAGCCTC-MGBNFQ)
LightCycler480 multiwell plate 96 (Roche, 04729692001)
LightCycler480 sealing foil (Roche, 04729757001)
Comment
This assay was performed in the assay providers lab. This assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal.
Result Definitions
Show more
TIDNameDescriptionPID§Panel TargetsHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
ScoreThe BioAssay activity ranking scoreInteger
1Timepoint 1: OutcomeThe BioAssay activity outcome1core protein [Hepatitis C virus]Outcome
2Timepoint 1: ScoreThe BioAssay activity ranking score1Integer
3Timepoint 1: IC50*The concentration at which 50 percent of the activity in the inhibitor assay is observed; (IC50) shown in micromolar.1FloatμM
4Timepoint 1: Inhibition at 100 uM [1] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate one.1Float%
5Timepoint 1: Inhibition at 100 uM [2] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate two.1Float%
6Timepoint 1: Inhibition at 100 uM [3] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate three.1Float%
7Timepoint 1: Inhibition at 10 uM [1] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate one.1Float%
8Timepoint 1: Inhibition at 10 uM [2] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate two.1Float%
9Timepoint 1: Inhibition at 10 uM [3] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate three.1Float%
10Timepoint 1: Inhibition at 1.0 uM [1] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate one.1Float%
11Timepoint 1: Inhibition at 1.0 uM [2] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate two.1Float%
12Timepoint 1: Inhibition at 1.0 uM [3] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate three.1Float%
13Timepoint 1: Inhibition at 0.1 uM [1] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate one.1Float%
14Timepoint 1: Inhibition at 0.1 uM [2] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate two.1Float%
15Timepoint 1: Inhibition at 0.1 uM [3] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate three.1Float%
16Timepoint 1: Inhibition at 0.01 uM [1] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate one.1Float%
17Timepoint 1: Inhibition at 0.01 uM [2] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate two.1Float%
18Timepoint 1: Inhibition at 0.01 uM [3] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate three.1Float%
19Timepoint 1: Inhibition at 0.001 uM [1] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate one.1Float%
20Timepoint 1: Inhibition at 0.001 uM [2] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate two.1Float%
21Timepoint 1: Inhibition at 0.001 uM [3] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate three.1Float%
22Timepoint 2: OutcomeThe BioAssay activity outcome2core protein [Hepatitis C virus]Outcome
23Timepoint 2: ScoreThe BioAssay activity ranking score2Integer
24Timepoint 2: IC50*The concentration at which 50 percent of the activity in the inhibitor assay is observed; (IC50) shown in micromolar.2FloatμM
25Timepoint 2: Inhibition at 100 uM [1] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate one.2Float%
26Timepoint 2: Inhibition at 100 uM [2] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate two.2Float%
27Timepoint 2: Inhibition at 100 uM [3] (100μM**)Value of % inhibition at 100 micromolar inhibitor concentration; replicate three.2Float%
28Timepoint 2: Inhibition at 10 uM [1] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate one.2Float%
29Timepoint 2: Inhibition at 10 uM [2] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate two.2Float%
30Timepoint 2: Inhibition at 10 uM [3] (10μM**)Value of % inhibition at 10 micromolar inhibitor concentration; replicate three.2Float%
31Timepoint 2: Inhibition at 1.0 uM [1] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate one.2Float%
32Timepoint 2: Inhibition at 1.0 uM [2] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate two.2Float%
33Timepoint 2: Inhibition at 1.0 uM [3] (1μM**)Value of % inhibition at 1.0 micromolar inhibitor concentration; replicate three.2Float%
34Timepoint 2: Inhibition at 0.1 uM [1] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate one.2Float%
35Timepoint 2: Inhibition at 0.1 uM [2] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate two.2Float%
36Timepoint 2: Inhibition at 0.1 uM [3] (0.1μM**)Value of % inhibition at 0.1 micromolar inhibitor concentration; replicate three.2Float%
37Timepoint 2: Inhibition at 0.01 uM [1] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate one.2Float%
38Timepoint 2: Inhibition at 0.01 uM [2] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate two.2Float%
39Timepoint 2: Inhibition at 0.01 uM [3] (0.01μM**)Value of % inhibition at 0.01 micromolar inhibitor concentration; replicate three.2Float%
40Timepoint 2: Inhibition at 0.001 uM [1] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate one.2Float%
41Timepoint 2: Inhibition at 0.001 uM [2] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate two.2Float%
42Timepoint 2: Inhibition at 0.001 uM [3] (0.001μM**)Value of % inhibition at 0.001 micromolar inhibitor concentration; replicate three.2Float%

* Activity Concentration. ** Test Concentration. § Panel component ID.
Additional Information
Grant Number: 1-X01-MH085709-01

PageFrom: