Bookmark and Share
BioAssay: AID 1637

NMR Based Screening Assay for Influenza A RNA Promoter

The RNA genome of influenza virus consists of eight single-stranded RNA molecules with the 5' and 3' ends of each RNA segment functioning as recognition promoter motifs for a viral RNA-dependent RNA polymerase (RdRp). The latter directs both transcription and replication of the virus's RNA genome. Promoter binding by the viral RNA polymerase and formation of an active open complex are prerequisites for viral replication and proliferation. ..more
_
   
 Tested Compounds
 Tested Compounds
All(3644)
 
 
Active(1)
 
 
Inactive(3643)
 
 
 Tested Substances
 Tested Substances
All(3677)
 
 
Active(1)
 
 
Inactive(3676)
 
 
 Related BioAssays
 Related BioAssays
AID: 1637
Data Source: Burnham Center for Chemical Genomics (BCCG-A166-InfluenzaRNAPromoter-NMR)
Depositor Category: NIH Molecular Libraries Screening Center Network
BioAssay Version:
Deposit Date: 2009-03-30
Modify Date: 2010-12-30

Data Table ( Complete ):           View Active Data    View All Data
Target
BioActive Compound: 1
Description:
Data Source: Sanford-Burnham Center for Chemical Genomics (SBCCG)
Source Affiliation: Sanford-Burnham Medical Research Institute (SBMRI, San Diego, CA)
Network: NIH Molecular Libraries Screening Centers Network (MLSCN)
Grant Number: R03MH082366
Assay Provider: Dr. Maurizio Pellecchia, Sanford-Burnham Medical Research Institute

The RNA genome of influenza virus consists of eight single-stranded RNA molecules with the 5' and 3' ends of each RNA segment functioning as recognition promoter motifs for a viral RNA-dependent RNA polymerase (RdRp). The latter directs both transcription and replication of the virus's RNA genome. Promoter binding by the viral RNA polymerase and formation of an active open complex are prerequisites for viral replication and proliferation.
The structure of this promoter was recently solved by multidimensional, heteronuclear magnetic resonance spectroscopy [1] indicating an unusual displacement of an adenosine that forms a novel (A-A) U motif and a C-A mismatch stacked in a helix. The hypothesis is that these unique structural features of the promoter imply that the specificity of polymerase binding results from an internal RNA loop. Because this function is unique to the viral RNA, it is possible in theory to devise small molecule inhibitors that by targeting the viral RNA promoter would disrupt the replication machinery of the virus. Here we screened our compound library by NMR to identify small compounds that binding to this promoter region would prevent.

1.Bae SH, Cheong HK, Lee JH, Cheong C, Kainosho M, Choi BS. Structural features of an influenza virus promoter and their implications for viral RNA synthesis. Proc. Natl. Acad. Sci. USA. 2001. 98(19):10602-7.
Protocol
1. RNA synthesis and sample preparation

The Influenza promoter RNA (5#fGAGUAGAAACAAGGCUUCGGCCUGCUUUUGCU3#f) was provided by Dr. Gabriele Varani at University of Washington, Seattle.

2. Compound Library Screened by NMR
We have assembled a scaffold library composed of ~ 4,000 compounds. The compounds have been selected based on their anticipated use as building blocks or scaffolds components of further optimized molecules. The scaffold library has been acquired from three different sources and the chemical structures of the library have been deposited into PubChem. In line with the general NIH Molecular Libraries Screening Centers Network (MLSCN) library, we have also included a collection of 602 Natural Products (MicroSource) that could be screened by NMR.

3. NMR Based Screening Description
a. Ligand binding was monitored by comparing the Imino region of 1D 1H NMR spectra of a 40 uM Influenza A promoter solution (100 uM sodium phosphate buffer at pH 6.25 containing 90%/10% H2O/2H2O; T = 287 K) in the presence and in absence of compounds tested at a final concentration of 100 uM. Compounds were initially tested at mixtures of 20, and then individual compounds for those mixtures that caused significant perturbations in the spectrum were subsequently tested.
b. Hit compounds with estimated Kd values of 100 uM or less are selected for further SAR studies. Analogues are selected and purchased directly from commercial sources and tested for binding to the target. SAR data are further analyzed to design additional analogues to be chemically synthesized.
4. Binding Constant Determination by NMR
The peak intensity of the imino proton of U26 will reduced upon binding with ligand. The Kd of ligand was estimated using the following equation:
One site binding:
Y=Bmax*X/(Kd+X)
Bmax is the maximal binding, and Kd is the concentration of ligand required to reach half-maximal binding.
Comment
A. The score is an estimate that reflects the binding affinity of the compound for the target and the accuracy of the method used to measure the dissociation constants. Compounds with an estimated Kd > 4000 uM are assigned a Kd of 4001 uM. Compounds for which we do not have a complete titration curve are scored on a scale from 0 to 40 according to the following scale:
Kd > 4000 uM Assigned Score 0
1000 500 < Kd < 1000 uM Assigned Score 20
100 < Kd < 500 uM Assigned Score 30
Kd < 100 uM Assigned Score 40

Kd values for compounds that scored 40 or better are treated as active and are subsequently measured more accurately by NMR titration. These molecules are scored on a scale from 50 to 100 as follows:

100< Kd <500 uM Assigned Score 50
50< Kd <100 uM Assigned Score 60
10 < Kd < 50 uM Assigned Score 70
1< Kd < 10 uM Assigned Score 80
0.1< Kd < 1 uM Assigned Score 90
Kd < 0.1 uM Assigned Score 100
Result Definitions
TIDNameDescriptionHistogramTypeUnit
OutcomeThe BioAssay activity outcomeOutcome
ScoreThe BioAssay activity ranking scoreInteger
1KdDissociation ConstantFloatμM
Additional Information
Grant Number: R03MH082366

Data Table (Concise)
Data Table ( Complete ):     View Active Data    View All Data
PageFrom: