Bookmark and Share
BioAssay: AID 1053170

Late stage counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput dose response assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotide

Name: Late stage counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput dose response assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotide ..more
 Tested Compounds
 Tested Compounds
 Tested Substances
 Tested Substances
AID: 1053170
Data Source: The Scripps Research Institute Molecular Screening Center (UHRF1-CPGDNA_INH_TRFRET_1536_3XIC50 MDCSRUN for MBD2-CPGDNA..)
BioAssay Type: Confirmatory, Concentration-Response Relationship Observed
Depositor Category: NIH Molecular Libraries Probe Production Network
Deposit Date: 2014-06-16
Hold-until Date: 2015-06-16
Modify Date: 2015-06-16

Data Table ( Complete ):           View Active Data    View All Data
BioActive Compounds: 2
Related Experiments
686964TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of 5-meCpG-binding domain protein 2 (MBD2)-DBD binding to methylated oligonucleotideScreeningdepositor-specified cross reference: Primary assay (MBD2-CPGDNA INH in singlicate)
686973Summary of a probe development effort to identify inhibitors of 5-meCpG-binding domain protein 2 (MBD2)-DBD binding to methylated oligonucleotideSummarydepositor-specified cross reference: Summary
687016Counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical primary high throughput screening assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotideScreeningdepositor-specified cross reference: Full Deck Counterscreen Assay (UHRF1-CPGDNA INH in singlicate)
720530Counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput screening assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotideScreeningdepositor-specified cross reference: Counterscreen Confirmation Assay (UHRF1-CPGDNA INH in triplicate)
720531TRFRET-based biochemical high throughput confirmation assay to identify inhibitors of 5-meCpG-binding domain protein 2 (MBD2)-DBD binding to methylated oligonucleotideScreeningdepositor-specified cross reference: Confirmation Assay (MBD2-CPGDNA INH in triplicate)
720644Counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput dose response assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotideConfirmatorydepositor-specified cross reference: Counterscreen Dose Response Assay (UHRF1-CPGDNA INH in triplicate)
720645TRFRET-based biochemical high throughput dose response assay to identify inhibitors of 5-meCpG-binding domain protein 2 (MBD2)-DBD binding to methylated oligonucleotideConfirmatorydepositor-specified cross reference: Dose Response Assay (MBD2-CPGDNA INH in triplicate)
1053169Late stage TRFRET-based biochemical high throughput dose response assay to identify inhibitors of 5-meCpG-binding domain protein 2 (MBD2)-DBD binding to methylated oligonucleotideConfirmatorysame project related to Summary assay
Source (MLPCN Center Name): The Scripps Research Institute Molecular Screening Center
Affiliation: The Scripps Research Institute, TSRI
Assay Provider: Bill Nelson
Network: Molecular Library Probe Production Centers Network (MLPCN)
Grant Proposal Number: 1 R03 MH098712-01
Grant Proposal PI: Bill Nelson
External Assay: UHRF1-CPGDNA_INH_TRFRET_1536_3XIC50 MDCSRUN for MBD2-CPGDNA INH (Round 0)

Name: Late stage counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput dose response assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotide


Of all the somatic genome changes that accumulate during the pathogenesis of human cancers, only changes in DNA methylation appear to occur consistently (virtually all cases), to arise early (first appearing in preneoplastic lesions), and to be potentially reversible (the DNA sequence remains intact) (1-4). One such change in DNA methylation, increased CpG dinucleotide methylation at CpG islands encompassing the transcriptional regulatory regions of many genes, leads to the transcriptional "silencing" of critical cancer genes (2, 5-6). CpG island hypermethylation has been reported to inhibit gene transcription by interfering with the binding and/or function of transcriptional trans-activators, or by recruiting 5-meCpG-binding domain (MBD) family proteins capable of mediating transcriptional repression (7). As many as 500 or more genes are epigenetically "silenced" in most human cancers. Two MBD family proteins have been implicated in the silencing of genes carrying abnormally hypermethylated CpG island sequences, MECP2 and MBD2. MBD2 binds 5-meCpG-DNA and is a component of a 1 MD transcription repression complex that also contains a chromatin remodeling complex subunits, histone-binding proteins, and a helicase/ATPase domain (8). Evidence suggests that MBD2-containing complexes are responsible for transcriptional repression accompanying somatic hypermethylation at pi-class glutathione S-transferase 1 (GSTP1), the most common genome change yet reported for prostate cancer, and a common alteration in breast and liver cancers (9-11). The goal of this project is the discovery and characterization of small molecule inhibitors of epigenetic gene silencing mediated by MBD2 and thus to identify compounds that will be able to reactivate the silenced genes in cancer cells, restoring gene function.


1. Brooks, J. D., Weinstein, M., Lin, X., Sun, Y., Pin, S. S., Bova, G. S., Epstein, J. I., Isaacs, W. B., and Nelson, W. G. (1998) CG island methylation changes near the GSTP1 gene in prostatic intraepithelial neoplasia, Cancer Epidemiol Biomarkers Prev 7, 531-536.
2. Herman, J. G., and Baylin, S. B. (2003) Gene silencing in cancer in association with promoter hypermethylation, N Engl J Med 349, 2042-2054.
3. Lin, X., Tascilar, M., Lee, W. H., Vles, W. J., Lee, B. H., Veeraswamy, R., Asgari, K., Freije, D., van Rees, B., Gage, W. R., Bova, G. S., Isaacs, W. B., Brooks, J. D., DeWeese, T. L., De Marzo, A. M., and Nelson, W. G. (2001) GSTP1 CpG island hypermethylation is responsible for the absence of GSTP1 expression in human prostate cancer cells, Am J Pathol 159, 1815-1826.
4. Nakayama, M., Bennett, C. J., Hicks, J. L., Epstein, J. I., Platz, E. A., Nelson, W. G., and De Marzo, A. M. (2003) Hypermethylation of the human glutathione S-transferase-pi gene (GSTP1) CpG island is present in a subset of proliferative inflammatory atrophy lesions but not in normal or hyperplastic epithelium of the prostate: a detailed study using laser-capture microdissection, Am J Pathol 163, 923-933.
5. Antequera, F., and Bird, A. (1993) Number of CpG islands and genes in human and mouse, Proc Natl Acad Sci U S A 90, 11995-11999.
6. Bird, A. P. (1986) CpG-rich islands and the function of DNA methylation, Nature 321, 209-213.
7. Bird, A. P., and Wolffe, A. P. (1999) Methylation-induced repression--belts, braces, and chromatin, Cell 99, 451-454.
8. Feng, Q., and Zhang, Y. (2001) The MeCP1 complex represses transcription through preferential binding, remodeling, and deacetylating methylated nucleosomes, Genes Dev 15, 827-832.
9. Bakker, J., Lin, X., and Nelson, W. G. (2002) Methyl-CpG binding domain protein 2 represses transcription from hypermethylated pi-class glutathione S-transferase gene promoters in hepatocellular carcinoma cells, J Biol Chem 277, 22573-22580.
10. Lin, X., and Nelson, W. G. (2003) Methyl-CpG-binding domain protein-2 mediates transcriptional repression associated with hypermethylated GSTP1 CpG islands in MCF-7 breast cancer cells, Cancer Res 63, 498-504.
11. Singal, R., van Wert, J., and Bashambu, M. (2001) Cytosine methylation represses glutathione S-transferase P1 (GSTP1) gene expression in human prostate cancer cells, Cancer Res 61, 4820-4826.


DCSRUN, counterscreen, secondary, triplicate, dose, dose response, titration, dilution, Ubiquitin-like containing PHD and RING finger domains 1, UHRF1, UHRF1-CpGDNA, UHRF1-CPGDNA, MBD2, MBD2-CpGDNA, Set-and RING-Associated, SRA, DNA replication, DNA methylation maintenance, DNA binding domain, cancer, singlicate, TRFRET, biochemical, Scripps, FRET, fluorescence, high throughput screen, 1536, HTS, Scripps Florida, MLSMR, The Scripps Research Institute Molecular Screening Center, SRIMSC, Molecular Libraries Probe Production Centers Network, MLPCN.
Assay Overview:

The purpose of this assay is to determine dose responses curves for available powder samples of compounds identified as active in a set of previous experiments entitled, "Counterscreen for inhibitors of 5-meCpG-binding domain protein 2 (MBD2): TRFRET-based biochemical high throughput dose response assay to identify inhibitors of binding of ubiquitin-like with PHD and ring finger domains 1 (UHRF1) to methylated oligonucleotide (PubChem AID 720644) are nonselective, as determined by inhibition of methylated DNA-binding activity of the SRA domain polypeptide of ubiquitin-like with PHD and ring finger domains 1 (UHRF1).

The UHRF1 gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. It contains a Set-and RING Associated (SRA) domain that binds to partially methylated DNA sequences during DNA synthesis. UHRF1 exhibits a different mode of DNA binding than MBD2, binding so-called hemi-methylated cytosines in order to promote their fully methylation. This assay is performed in a similar manner as the MBD2 screen, except that it employs recombinant UHRF1 SRA domain protein (UHRF1_SRA) and hemi-methylated DNA as its substrate. This assay monitors the ability of compounds to inhibit binding of cloned recombinant UHRF1_SRA to a FAM-labeled 14 bp hairpin oligonucleotide containing a hemimethylated CpG. In this biochemical assay, test compounds are incubated with UHRF1_SRA and a 5-carboxyfluorescene (FAM)-labeled 14bp hairpin DNA oligonucleotide containing one hemimethylated CpG dinucleotide in the presence of Tb-labeled anti-His antibody. An inhibitor of the UHRF1_SRA:FAM hemimethylated CpG interaction will inhibit binding between UHRF1 and FAM hemimethylated oligo, leading to reduced energy transfer and reduced well FRET (fluorescein emission / Tb emission). Compounds are tested in triplicate using a 10-point 1:3 dilution series starting at a maximum nomimal test concentration of 43.8 uM.

Protocol Summary:

The assay was started by dispensing 5 microliters of Control Mix in assay buffer (4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 125 mM NaCl, 10 mM Tris-HCl (pH 7.4), and 0.2% Tween-20) containing 125 nanomolar of UHRF1 protein, 100 nanomolar FAM labeled Hemimethylated CpG DNA oligo, 5 micromolar of Unlabeled methylated CpG DNA oligo and 5 nanomolar of Terbium labeled anti-his antibody into columns 1 thru columns 2 of 1536 microtiter plates. Next, 5 microliters of Experimental Mix containing 125 nanomolar of UHRF1 protein, 100 nanomolar FAM labeled Hemimethylated CpG DNA oligo and 5 nanomolar Terbium labeled anti-his antibody in assay buffer were dispensed into columns 3 thru 48. Then, the plates were centrifuged and pinned with 22 nL of test compound in DMSO, Mitoxantrone (1.3 micromolar final concentration) in DMSO or DMSO alone (0.44% final concentration). The plates were incubated for 60 minutes at 25 degrees Celsius and TR-FRET was measured on a Viewlux microplate reader (Perkin Elmer, Turku, Finland). After excitation at 340 nm, well fluorescence was monitored at 495 nm (Tb) and 525 nm (FAM). For each well, a fluorescence ratio was calculated according to the following mathematical expression:
Ratio = I525nm / I495nm


I525nm represents the measured fluorescence emission at 525 nm.
I495nm represents the measured fluorescence emission at 495 nm.

The percent inhibition for each compound was calculated using as follows:

%_Inhibition = 100 * ( Ratio_Test_Compound - Median_Ratio_Low_Control ) / ( Median_Ratio_High_Control - Median_Ratio_Low_Control ) )


Test_Compound is defined as wells containing the Experimental Mix in the presence of test compound.
High_Control is defined as wells containing the Experimental Mix, Mitoxantrone and DMSO.
Low_Control is defined as wells containing the Experimental Mix and DMSO.

PubChem Activity Outcome and Score:

For each test compound, percent inhibition was plotted against compound concentration. A four parameter equation describing a sigmoidal dose-response curve was then fitted with adjustable baseline using Assay Explorer software (Symyx Technologies Inc). The reported IC50 values were generated from fitted curves by solving for the X-intercept value at the 50% inhibition level of the Y-intercept value. In cases where the highest concentration tested (i.e. 43.8 uM) did not result in greater than 50% inhibition, the IC50 was determined manually as greater than 43.8 uM.

Compounds with an IC50 greater than 10 uM were considered inactive. Compounds with an IC50 equal to or less than 10 uM were considered active.

Any compound with a percent activity value < 50% at all test concentrations was assigned an activity score of zero. Any compound with a percent activity value >= 50% at any test concentration was assigned an activity score greater than zero. Activity score was then ranked by the potency, with the most potent compounds assigned the highest activity scores.

The PubChem Activity Score range for active compounds is 100-1, and for inactive compounds 0-0.

List of Reagents:

UHRF1_SRA protein (supplied by Assay Provider)
FAM labeled Hemimethylated CpG DNA Oligo (IDT-custom oligo sequence- 5#- /56-FAM/ATGCT/iMedC/GTAGCACTTTTGTGCTACGAGCAT -3#)
Unlabeled Methylated CpG DNA Oligo (IDT-custom oligo sequence- 5#- ATGCT /iMe-dC/GTAGCACTTTTGTGCTA /iMe-dC/GAGCAT -3#)
Lanthascreen Tb Anti-His Antibody (Invitrogen, part PV5895)
MgCl2 (Fisher, part BP214)
NaCl (Sigma, part S6546)
DTT (Fisher, part BP172)
EDTA (Sigma, part E7889)
Tris (Amresco, part 0497)
Tween 20 (Sigma, part P9416)
Glycerol (Sigma, part G7893)
1536-well plates (Corning, part 7261)

This assay may have been run as two or more separate campaigns, each campaign testing a unique set of compounds. All data reported were normalized on a per-plate basis. Possible artifacts of this assay can include, but are not limited to: dust or lint located in or on wells of the microtiter plate, compounds that modulate well fluorescence. All test compound concentrations reported above and below are nominal; the specific test concentration(s) for a particular compound may vary based upon the actual sample provided.
Categorized Comment - additional comments and annotations
From BioAssay Depositor:
Assay: CurveFit [1]: Equation: =( ( [Maximal Response] * [Concentration]^[Hill Slope] ) / ( [Inflection Point Concentration]^[Hill Slope] + [Concentration]^[Hill Slope] ) ) + [Baseline Response]
Assay: CurveFit [1]: Mask: Excluded Points
Assay: Dictionary: Version: 0.1
Result Definitions
Show more
OutcomeThe BioAssay activity outcomeOutcome
ScoreThe BioAssay activity ranking scoreInteger
1Qualifierinhibition Qualifier identifies if the resultant data IC50 came from a fitted curve or was determined manually to be less than or greater than its listed IC50 concentration.String
2IC50*The concentration at which 50 percent of the inhibition in the inhibitor assay is observed; (IC50) shown in micromolar.FloatμM
3LogIC50Log10 of the qualified IC50 (IC50) from the inhibitor assay in M concentrationFloat
4Maximal ResponseThe maximal or asymptotic response above the baseline as concentration increases without bound.Float
5Baseline ResponseAdjustable baseline of the curve fit, minimal response value.Float
6Inflection Point ConcentrationThe concentration value for the inflection point of the curve.FloatμM
7Chi SquareA measure for the 'goodness' of a fit. The chi-square test (Snedecor and Cochran, 1989) is used to test if a sample of data came from a population with a specific distribution.Float
8RsquareThis statistic measures how successful the fit explains the variation of the data; R-square is the square of the correlation between the response values and the predicted response values.Float
9Number of DataPointsOverall number of data points of normalized percent inhibition that was used for calculations (includes all concentration points); in some cases a data point can be excluded as outlier.Integer
10Hill SlopeThe variable HillSlope describes the steepness of the curve. This variable is called the Hill slope, the slope factor, or the Hill coefficient. If it is positive, the curve increases as X increases. If it is negative, the curve decreases as X increases. A standard sigmoid dose-response curve (previous equation) has a Hill Slope of 1.0. When HillSlope is less than 1.0, the curve is more shallow. When HillSlope is greater than 1.0, the curve is steeper. The Hill slope has no units.Float
11Response RangeThe range of Y.Float
12Excluded PointsFlags to indicate which of the dose-response points were excluded from analysis. (1) means the point was excluded and (0) means the point was not excluded.String
13Inhibition at 0.0022 uM [1] (0.0022μM**)Value of % inhibition at 0.0022 uM compound concentration; replicate [1]Float%
14Inhibition at 0.0022 uM [2] (0.0022μM**)Value of % inhibition at 0.0022 uM compound concentration; replicate [2]Float%
15Inhibition at 0.0022 uM [3] (0.0022μM**)Value of % inhibition at 0.0022 uM compound concentration; replicate [3]Float%
16Inhibition at 0.0067 uM [1] (0.0067μM**)Value of % inhibition at 0.0067 uM compound concentration; replicate [1]Float%
17Inhibition at 0.0067 uM [2] (0.0067μM**)Value of % inhibition at 0.0067 uM compound concentration; replicate [2]Float%
18Inhibition at 0.0067 uM [3] (0.0067μM**)Value of % inhibition at 0.0067 uM compound concentration; replicate [3]Float%
19Inhibition at 0.02 uM [1] (0.02μM**)Value of % inhibition at 0.02 uM compound concentration; replicate [1]Float%
20Inhibition at 0.02 uM [2] (0.02μM**)Value of % inhibition at 0.02 uM compound concentration; replicate [2]Float%
21Inhibition at 0.02 uM [3] (0.02μM**)Value of % inhibition at 0.02 uM compound concentration; replicate [3]Float%
22Inhibition at 0.06 uM [1] (0.06μM**)Value of % inhibition at 0.06 uM compound concentration; replicate [1]Float%
23Inhibition at 0.06 uM [2] (0.06μM**)Value of % inhibition at 0.06 uM compound concentration; replicate [2]Float%
24Inhibition at 0.06 uM [3] (0.06μM**)Value of % inhibition at 0.06 uM compound concentration; replicate [3]Float%
25Inhibition at 0.18 uM [1] (0.18μM**)Value of % inhibition at 0.18 uM compound concentration; replicate [1]Float%
26Inhibition at 0.18 uM [2] (0.18μM**)Value of % inhibition at 0.18 uM compound concentration; replicate [2]Float%
27Inhibition at 0.18 uM [3] (0.18μM**)Value of % inhibition at 0.18 uM compound concentration; replicate [3]Float%
28Inhibition at 0.54 uM [1] (0.54μM**)Value of % inhibition at 0.54 uM compound concentration; replicate [1]Float%
29Inhibition at 0.54 uM [2] (0.54μM**)Value of % inhibition at 0.54 uM compound concentration; replicate [2]Float%
30Inhibition at 0.54 uM [3] (0.54μM**)Value of % inhibition at 0.54 uM compound concentration; replicate [3]Float%
31Inhibition at 1.6 uM [1] (1.6μM**)Value of % inhibition at 1.6 uM compound concentration; replicate [1]Float%
32Inhibition at 1.6 uM [2] (1.6μM**)Value of % inhibition at 1.6 uM compound concentration; replicate [2]Float%
33Inhibition at 1.6 uM [3] (1.6μM**)Value of % inhibition at 1.6 uM compound concentration; replicate [3]Float%
34Inhibition at 4.9 uM [1] (4.9μM**)Value of % inhibition at 4.9 uM compound concentration; replicate [1]Float%
35Inhibition at 4.9 uM [2] (4.9μM**)Value of % inhibition at 4.9 uM compound concentration; replicate [2]Float%
36Inhibition at 4.9 uM [3] (4.9μM**)Value of % inhibition at 4.9 uM compound concentration; replicate [3]Float%
37Inhibition at 14.6 uM [1] (14.6μM**)Value of % inhibition at 14.6 uM compound concentration; replicate [1]Float%
38Inhibition at 14.6 uM [2] (14.6μM**)Value of % inhibition at 14.6 uM compound concentration; replicate [2]Float%
39Inhibition at 14.6 uM [3] (14.6μM**)Value of % inhibition at 14.6 uM compound concentration; replicate [3]Float%
40Inhibition at 43.8 uM [1] (43.8μM**)Value of % inhibition at 43.8 uM compound concentration; replicate [1]Float%
41Inhibition at 43.8 uM [2] (43.8μM**)Value of % inhibition at 43.8 uM compound concentration; replicate [1]Float%
42Inhibition at 43.8 uM [3] (43.8μM**)Value of % inhibition at 43.8 uM compound concentration; replicate [3]Float%

* Activity Concentration. ** Test Concentration.
Additional Information
Grant Number: 1 R03 MH098712-01

Data Table (Concise)
Data Table ( Complete ):     View Active Data    View All Data